What's new

Hình ảnh điện di !

Ho Huu Tho

Member
Thanks bạn Hiếu nhé, có phải ý bạn nói lấy sản phẩm p/ư PCR đó làm vật liệu rồi tiếp tục chạy tiếp PCR lần nữa không. cái này mình cũng thử làm rồi, có phản ứng cho kết quả tốt hơn cho hình ảnh băng sáng rõ lét hơn nhưng cũng có phản ứng cho kết quả không tốt bằng kq chỉ chạy PCR một lần. Có ai đã làm và gặp như thế chưa nhỉ, giải thích giúp mình nhé !(y)
Theo tôi, phần in đậm của bạn có thể được giải thích bằng một số lý do như sau:
- Sản phẩm PCR của lần 1 bao gồm hai phần: sản phẩm PCR như bạn mong muốn + sản phẩm phụ (mispriming, dimer). Trong PCR thứ hai thì cả hai sản phẩm này cùng được nhân lên. Tùy thuộc vào tỉ lệ hai sản phẩm này có trong PCR lần một như thế nào sẽ quyết định kết quả của PCR lần hai.
Để khắc phục được nguyên nhân này bạn nên dùng cặp mồi khác cho PCR thứ hai (thiết kế theo kiểu nested hoặc semi-nested), như vậy thì chỉ có sản phẩm PCR mong muốn được nhân trong PCR lần hai.
- Trong sản phẩm của phản ứng PCR lần một có thể có một số chất ức chế phản ứng PCR lần hai.
Để khắc phục được nguyên nhân này thì bạn có thể pha loãng sản phẩm của PCR lần một ở mức độ nhất định để dùng làm template cho PCR lần hai.
 
Theo tôi, phần in đậm của bạn có thể được giải thích bằng một số lý do như sau:
- Sản phẩm PCR của lần 1 bao gồm hai phần: sản phẩm PCR như bạn mong muốn + sản phẩm phụ (mispriming, dimer). Trong PCR thứ hai thì cả hai sản phẩm này cùng được nhân lên. Tùy thuộc vào tỉ lệ hai sản phẩm này có trong PCR lần một như thế nào sẽ quyết định kết quả của PCR lần hai.
Để khắc phục được nguyên nhân này bạn nên dùng cặp mồi khác cho PCR thứ hai (thiết kế theo kiểu nested hoặc semi-nested), như vậy thì chỉ có sản phẩm PCR mong muốn được nhân trong PCR lần hai.
- Trong sản phẩm của phản ứng PCR lần một có thể có một số chất ức chế phản ứng PCR lần hai.
Để khắc phục được nguyên nhân này thì bạn có thể pha loãng sản phẩm của PCR lần một ở mức độ nhất định để dùng làm template cho PCR lần hai.
Cảm ơn bạn Thọ về những giải thích của bạn nhé.
Có một vấn đề này mong các bạn có kinh nghiệm giúp mình nhé: mình có đoạn gene muốn nhân bản, mình đã dùng phần mềm Frimer5 và Primer Blast để thiết kế mồi, nhưng không biết do sai sót ở khâu nào (do thiết kế mồi không chuẩn hay do quá trình thao tác PCR) mà làm mãi khi điên di kiểm tra kết quả cũng chỉ thấy đoạn gene có kích thước bằng hoặc nhỏ hơn đoạn gene ban đầu. Bạn nào đã làm nhiều cho mình xin ít kinh nghiệm hoặc thiết kế giúp mình một vài đôi primer để có thể nhân bản đoạn gene này nhé !
đoạn gene như sau:
CGACGGCCAGTGCCAAGCTTGCATGCCTGCAGGTCGACGATTCCATCCTCTTGCCTCCCCTTGGTGTCTTCCTTAAGTTCGGTTGCGAGGTGGAGTTTTGGATCTGTCTGTTACTGACCTTGTTTGGATATCTCCCTGGAATTCTCTATGCTATTTATATCATCACCAAGTGATCATCTCTCTCTCTCTCTAGGTGGAGATGTGAGGGGTGACAATAAAAAGTCCTTTTCATTTCTGCTAATGGAGGAGGTGCTTATATATACCCAACGACGGCTCGATGAACAGTGATGATTTGTGGGGTCTAAAGATGATTTCATTCTTGTTTTGGGGGTTATTTTGATTTTGAATTTTAGGACTGGTAATTGGGTTTTGTAATTATTGTGTTGTTGGGTTGTTGATTTTAGTAGTTTAGTTTTGTCTTAAATTAAGATCATGAAATTTAATTTTCAGTGTTCGAATTTTTTGTTTATGTATTGATTTAAACCTTAATTAATTTTCCTATTTGTGCTATATCAGTAATAGTTTTGTTTTTTCGCA
(Khi tiến hành phản ứng PCR, căn cứ vào nhiệt độ mồi nhà sản xuất tính toán, Tm của p/u mình đã khảo sát theo gradient nhiệt độ mà nhà sản xuất đưa ra để tìm ra nhiệt độ tối ưu cho phản ứng)(y)
 

Ho Huu Tho

Member
Cảm ơn bạn Thọ về những giải thích của bạn nhé.
Có một vấn đề này mong các bạn có kinh nghiệm giúp mình nhé: mình có đoạn gene muốn nhân bản, mình đã dùng phần mềm Frimer5 và Primer Blast để thiết kế mồi, nhưng không biết do sai sót ở khâu nào (do thiết kế mồi không chuẩn hay do quá trình thao tác PCR) mà làm mãi khi điên di kiểm tra kết quả cũng chỉ thấy đoạn gene có kích thước bằng hoặc nhỏ hơn đoạn gene ban đầu. (y)
Phần mềm bạn sử dụng tôi chưa được nghe đến bao giờ, đó là phần mềm thương mại hay miễn phí vậy bạn?
Tôi vẫn chưa hiểu vấn đề bạn gặp phải là gì, bạn có thể nói rõ hơn được không?
 

mnhung

Member
bạn xem ảnh điện di rồi góp ý cho mình nhé. hình 1 sau điện di 15', hình 2 sau điện di 20', hình 3 sau điện di 25'. mình nghĩ có thể mẫu điện di bị nhiễm nhưng thắc mắc là tại sao băng sáng lại chạy ngược về phía giếng. thanks.
theo tôi thấy thì hình 3 thì thấy không có hiện tượng chạy ngược lại vì không tìm thấy band:)
 
Mình thường dùng phần mềm miễn phí FastPCR và thấy rất ổn, bạn thử download nó về dùng thử xem. Nếu bạn muốn nhân đoạn gene đó thì bạn phải lấy trình tự dài hơn, chứa toàn bộ đoạn đó, để làm thôgn tin thiết kế mồi chứ.
Cảm ơn bạn Thọ về những giải thích của bạn nhé.
Có một vấn đề này mong các bạn có kinh nghiệm giúp mình nhé: mình có đoạn gene muốn nhân bản, mình đã dùng phần mềm Frimer5 và Primer Blast để thiết kế mồi, nhưng không biết do sai sót ở khâu nào (do thiết kế mồi không chuẩn hay do quá trình thao tác PCR) mà làm mãi khi điên di kiểm tra kết quả cũng chỉ thấy đoạn gene có kích thước bằng hoặc nhỏ hơn đoạn gene ban đầu. Bạn nào đã làm nhiều cho mình xin ít kinh nghiệm hoặc thiết kế giúp mình một vài đôi primer để có thể nhân bản đoạn gene này nhé !
đoạn gene như sau:

CGACGGCCAGTGCCAAGCTTGCATGCCTGCAGGTCGACGATTCCATCCTCTTGCCTCCCCTTGGTGTCTTCCTTAAGTTCGGTTGCGAGGTGGAGTTTTGGATCTGTCTGTTACTGACCTTGTTTGGATATCTCCCTGGAATTCTCTATGCTATTTATATCATCACCAAGTGATCATCTCTCTCTCTCTCTAGGTGGAGATGTGAGGGGTGACAATAAAAAGTCCTTTTCATTTCTGCTAATGGAGGAGGTGCTTATATATACCCAACGACGGCTCGATGAACAGTGATGATTTGTGGGGTCTAAAGATGATTTCATTCTTGTTTTGGGGGTTATTTTGATTTTGAATTTTAGGACTGGTAATTGGGTTTTGTAATTATTGTGTTGTTGGGTTGTTGATTTTAGTAGTTTAGTTTTGTCTTAAATTAAGATCATGAAATTTAATTTTCAGTGTTCGAATTTTTTGTTTATGTATTGATTTAAACCTTAATTAATTTTCCTATTTGTGCTATATCAGTAATAGTTTTGTTTTTTCGCA


(Khi tiến hành phản ứng PCR, căn cứ vào nhiệt độ mồi nhà sản xuất tính toán, Tm của p/u mình đã khảo sát theo gradient nhiệt độ mà nhà sản xuất đưa ra để tìm ra nhiệt độ tối ưu cho phản ứng)(y)
 
Thực sự có một kinh-nghiêm-thực-tế như đã nói ở trên khi tách chiết ADN tổng số từ lá chè, ở đây là em làm thí nghiệm với mẫu lá chè trong đề tài nào đó thầy Mùi - Khoa Hóa sinh - HUS từ những năm cuối 2003 - 2004. Các ACE nào đã từng làm thí nghiệm tách chiết ADN từ thực vật, đặc biệt là lá chè (chắc có nhiều tanin) thì cho ý kiến nhé!
Tôi dùng Protocol này để chiết DNA từ lá chè, kết quả: ok
http://www.agrarkutatas.net/files/aktualis/pdf_agroinform_20070220133118_4_Bokszczanin.pdf
 

Mr.Banana

New member
vấn đề này mình nghĩ là do thao tác điện di thôi, thường thì khi đã dừng lại rồi mà chạy tiếp thì sản phẩm sẽ điện di sẽ bị hóng!
Mà các bác cho e hỏi chạy agarose 1.1% có phân tách nổi đoạn DNA kích thước 100bp ko?? vì e chuyên làm về SSR các sp PCR đều kích thước rất nhỏ fải điện di trên gel Polyacrylamide mới có thể cho thấy sự khác biệt! Như bạn Hưng mình nghĩ DNA sample vẫn OK, PCR vẫn OK thôi!
Một điều đương nhiên là thời gian điện di càng lâu thì khả năng phân tách càng cao. nếu bạn chạy lâu thì các đoạn có kích thước khác nhau sẽ tiếp tục phân tách đi, khi đó các band của bạn sẽ ko nét như lúc đầu nữa.
Đây cũng chỉ là kinh nghiệm của mình thôi! có j` ko đúng mong mọi người chỉ bảo thêm.
 

Mr.Banana

New member
Xin lỗi, Comment thêm 1 chút! mình chạy sản phẩm PCR trên agarose toàn chạy nồng độ cao thôi khảng 3.5% đến 8% chạy có khi mất 3-4h mới có kết quả điện di, khi đó kết quả cũng chính xác lắm. các band lên gọn và chuẩn kích thước nữa! chứ chạy agarose 1.1% mình chỉ dùng để kiểm tra xem PƯ PCR của mình có lên hay ko thôi
 

Ho Huu Tho

Member
Xin lỗi, Comment thêm 1 chút! mình chạy sản phẩm PCR trên agarose toàn chạy nồng độ cao thôi khảng 3.5% đến 8% chạy có khi mất 3-4h mới có kết quả điện di, khi đó kết quả cũng chính xác lắm. các band lên gọn và chuẩn kích thước nữa! chứ chạy agarose 1.1% mình chỉ dùng để kiểm tra xem PƯ PCR của mình có lên hay ko thôi
Mình thấy gel 3% đã khó đổ lắm rồi, không biết 8% thì bạn đổ gel bằng cách nào, có bí quyết gì không?
 

Facebook

Top