What's new

Chương trình xác định trình tự sợi DNA bổ sung

#1
Có ai có phần mền xác định trình tự của sợi DNA bổ sung cũng như vị trí gắn mồi không ạ!
cho em xin với! :cry:
Em cảm ơn các anh chị trong dd nhiều lắm!!
 

Ho Huu Tho

Member
Bạn nêu rõ hơn bạn muốn làm gì với các trình tự để xem mọi người có thể giúp được không.
 
Em cảm ơn a Ho Huu Tho nhiều!
>> E có một trình tự RNA của IL8 như thế này
1 gagggtgcat aagttctcta gtagggtgat gatataaaaa gccaccggag cactccataa

61 ggcacaaact ttcagagaca gcagagcaca caagcttcta ggacaagagc caggaagaaa

121 ccaccggaag gaaccatctc actgtgtgta aacatgactt ccaagctggc cgtggctctc

181 ttggcagcct tcctgatttc tgcagctctg tgtgaaggtg cagttttgcc aaggagtgct

241 aaagaactta gatgtcagtg cataaagaca tactccaaac ctttccaccc caaatttatc

301 aaagaactga gagtgattga gagtggacca cactgcgcca acacagaaat tattgtaaag

361 ctttctgatg gaagagagct ctgtctggac cccaaggaaa actgggtgca gagggttgtg

421 gagaagtttt tgaagagggc tgagaattca taaaaaaatt cattctctgt ggtatccaag

481 aatcagtgaa gatgccagtg aaacttcaag caaatctact tcaacacttc atgtattgtg

541 tgggtctgtt gtagggttgc cagatgcaat acaagattcc tggttaaatt tgaatttcag

601 taaacaatga atagtttttc attgtaccat gaaatatcca gaacatactt atatgtaaag

661 tattatttat ttgaatctac aaaaaacaac aaataatttt taaatataag gattttccta

721 gatattgcac gggagaatat acaaatagca aaattgaggc caagggccaa gagaatatcc

781 gaactttaat ttcaggaatt gaatgggttt gctagaatgt gatatttgaa gcatcacata

841 aaaatgatgg gacaataaat tttgccataa agtcaaattt agctggaaat cctggatttt

901 tttctgttaa atctggcaac cctagtctgc tagccaggat ccacaagtcc ttgttccact

961 gtgccttggt ttctccttta tttctaagtg gaaaaagtat tagccaccat cttacctcac

1021 agtgatgttg tgaggacatg tggaagcact ttaagttttt tcatcataac ataaattatt

1081 ttcaagtgta acttattaac ctatttatta tttatgtatt tatttaagca tcaaatattt

1141 gtgcaagaat ttggaaaaat agaagatgaa tcattgattg aatagttata aagatgttat

1201 agtaaattta ttttatttta gatattaaat gatgttttat tagataaatt tcaatcaggg

1261 tttttagatt aaacaaacaa acaattgggt acccagttaa attttcattt cagataaaca

1321 acaaataatt ttttagtata agtacattat tgtttatctg aaattttaat tgaactaaca

1381 atcctagttt gatactccca gtcttgtcat tgccagctgt gttggtagtg ctgtgttgaa

1441 ttacggaata atgagttaga actattaaaa cagccaaaac tccacagtca atattagtaa

1501 tttcttgctg gttgaaactt gtttattatg tacaaataga ttcttataat attatttaaa

1561 tgactgcatt tttaaataca aggctttata tttttaactt taagatgttt ttatgtgctc

1621 tccaaatttt ttttactgtt tctgattgta tggaaatata aaagtaaata tgaaacattt

1681 aaaatataat ttgttgtcaa agtaaaaaaa aaaaaaaa

Với các cặp mồi sau:

Sense primer (outer) TTTCTGATGGAAGAGAGCTCTGTCT
Antisense primer (outer) ATCTTCACTGATTCTTGGATACCACA
Sense primer
(iner) CCAAGGAAAACTGGGTGCAG
Antisense primer
(iner) CTTGGATACCACAGAGAATGAATTTTT


>> E muốn xác định độ dài amplicon với cặp outer và iner, vị trí bắt mồi, cũng như xác định xem sản phẩm của đoạn iner có nằm trong đoạn outer trong nested PCR hay không?

Do e ko chuyên về sinh học nên gặp nhiêu rắc rối với những điều đơn giản thế này mong a Tho cũng như các a chị trong diễn đàn giúp e với! :please:
 
Last edited:

Ho Huu Tho

Member
Mình dùng phần mềm thương mại OLIGO để thiết kế mồi thì yêu cầu như của bạnt thực hiện khá đơn giản, nhưng mình đoán bạn không có những phần mềm như vậy. Mình không biết các phần mềm free như primer 3 thì có chức năng bạn cần không, bạn thử tìm hiểu xem sao. Bạn cũng có thể sử dụng lệnh Search của Word để tìm vị trí bắt cặp của mồi trên template (lưu ý phải sử dụng trình tự bổ sung của mồi ngược khi tìm vị trí bắt cặp của mồi ngược trên template). Bạn có thể xác định trình tự bổ sung của mồi ở trang này:http://www.basic.northwestern.edu/biotools/OligoCalc.html
 
Bạn có thể dùng BioEdit. Mình vẫn dùng nó để xác định vị trí gắn mồi và độ dài amplicon. Có điều thao tác không được thuận tiện cho lắm.

BioEdit có ưu điểm lớn nhất là miễn phí, ngoài ra nó tích hợp rất nhiều công cụ khác mà mình không biết hết (và không biết có hỗ trợ thiết kế oligo không).
 
(y) 2 Anh Ho Huu Tho và Đinh Duy Thành nhiều lắm! (y)

Em còn có vấn đề này mong nhận được sự giải đáp từ các thành viên trong dd!!

- Thường thì các RNA có nguồn gốc ngoại bào rất dễ bị suy thoái, nên nếu muốn ngăn cản việc này thì RNA phải liên kết với các đại phân tử ( MUC5B,MUC7, apoptotic,..).
>> Vậy RNA bị suy thoái là do tác nhân gì? và làm sao để chúng tạo được liên kết?
:please::cry:
 
có ai thực hiện điện di mao quản để xác định trình tự chưa. cho mình hỏi cấu tạo của ống mao quản (càng kỹ càng tốt)
 

Facebook

Top