What's new

Ligation: đang gặp vấn đề

tôi đang tìm cái Promotor cua FcgammaRIV, nhưng đang gặp một số vấn đề ở Ligation. sản phẩm PCR của tôi có loại là 500bp, 1000bp, 1500bp, digestion voi HindIII, NheI, Vector pGL-3 Basic, Ligation voi 2 tỉ lệ vecktor- insert là : 1-3 va 1-10.
transfomation thì 1-10 thường nhiều colony hơn.
sau đó kiểm tra lại thì chu yếu của insert 500kb với tỷ lệ 1-10 là tạm ok ( đang gửi đi sequencing), 1000bp thi được 1 cái, còn 1500bp thi đã làm lại nhưng cũng không Ligation thanh công, riêng 1000 và 1500 đã làm lại và tăng gấp đôi lượng của cả vektor và insert mà vẫn không được như ý Ligase la T4 0202s của new england biolabs.
tôi nghĩ có thể insert 1000 và 1500 lớn, nên có thể khối lượng ảnh hưởng đến ligation chăng...??!!
nói chung là tôi nghĩ mãi chưa ra lỗi lầm ở chõ nào mà không ligation thành công, công việc lu bu nên cũng không ngồi hệ thống lại được xem sai chỗ nào.
mong các bác ở ngoài tỉnh táo hơn, và quan trọng là nhiều kinh nghiệm chỉ giùm..
( thời gian của đợt thực tập labor sắp hết mà cứ lọ mọ một mình thế này ... kiểu này chắc phải kéo dài thêm vài tuần..hic:banbo:)
(y)
 
Vụ này em cũng bị rồi, loay hoay hoài mà không nối được đoạn DNA kích thước trên 1kb vô vector. Vì vector của anh nó khoàng hơn 5kb, DNA cần nối thì chiếm 1.5kb, tỉ lệ của kích thước sản phẩm nối với vector là rất cao. Thường hồi đó em dùng cả tỉ lệ 1 vector: 10 DNA đến 1:15 và 1:20. Sau đó biến nạp cùng một lúc rồi PCR colony.

Nhưng em thấy nối kiểu này nhiều khi cũng hên xui lắm, làm cả chục lần hoặc hơn mới ăn nhặp được một colony.
 

Nguyễn Xuân Hưng

Administrator
1. Tính tỷ lệ vector:insert theo cách nào?

2. Thường thì ligation không thành công là do bước digest bằng 2 RE. Còn kích thước thì chẳng ảnh hưởng mấy. Quan trọng nhất là sản phẩm PCR, nêu ra đây xem bạn design primer với restriction site như thế nào. Bước digest bằng 2 RE ra sao? Còn ligation là cái dễ nhất trên đời, chẳng phải làm nhiều tỉ lệ làm gì cứ 1:3 là được rồi.

Goodluck
 
Nhưng anh Hưng ơi, quan trọng là RE em sài cũng toàn là loại mạnh (EcoRI, BamHIr..), PCR product và plasmid sau khi cắt được tinh chế qua gel sạch sẽ bằng Kit (quiagen) đảm bảo độ sạch. Mọi hóa chất đều OK, nhưng sài 1:3 không ăn nhặp gì. vậy tại sao anh? trong khi bình thường em nối đoạn DNA khoảng 500bp vô plasmid 5kb thì vô vèo vèo.
 

Nguyễn Xuân Hưng

Administrator
Nhưng anh Hưng ơi, quan trọng là RE em sài cũng toàn là loại mạnh (EcoRI, BamHIr..), PCR product và plasmid sau khi cắt được tinh chế qua gel sạch sẽ bằng Kit (quiagen) đảm bảo độ sạch. Mọi hóa chất đều OK, nhưng sài 1:3 không ăn nhặp gì. vậy tại sao anh? trong khi bình thường em nối đoạn DNA khoảng 500bp vô plasmid 5kb thì vô vèo vèo.

Quan trọng khi digest sản phẩm PCR là hai đầu restriction site dài ngắn thế nào. Chẳng hạn sản phẩm PCR thu được là

GAATTCNNNNNNNNNNNNNNNNNGAATTC sẽ khó digest bằng EcoRI hơn

NNNNNGAATTCNNNNNNNNNNNNNNNNNGAATTCNNNNNN

Enzyme mạnh thì rõ nhưng còn tùy thuộc dùng bao nhiêu unit, dành bao nhiêu thời gian để digest, và digest bao nhiêu DNA (ng) còn phụ thuộc digest bằng 2 RE thì chiến lược thế nào, đồng thời add cả hai một lúc, hay add lần lượt, hay digest bằng 1 RE rồi tinh sạch rồi add RE thứ 2. Nhiều thứ lắm.

Thường thì tôi digest 3 ug DNA dùng 20 U RE trong tối thiểu 3h, add cùng lúc hoặc 1 RE vào trước rồi 2h sau add RE.
 
Quan trọng khi digest sản phẩm PCR là hai đầu restriction site dài ngắn thế nào. Chẳng hạn sản phẩm PCR thu được là

GAATTCNNNNNNNNNNNNNNNNNGAATTC sẽ khó digest bằng EcoRI hơn

NNNNNGAATTCNNNNNNNNNNNNNNNNNGAATTCNNNNNN

Enzyme mạnh thì rõ nhưng còn tùy thuộc dùng bao nhiêu unit, dành bao nhiêu thời gian để digest, và digest bao nhiêu DNA (ng) còn phụ thuộc digest bằng 2 RE thì chiến lược thế nào, đồng thời add cả hai một lúc, hay add lần lượt, hay digest bằng 1 RE rồi tinh sạch rồi add RE thứ 2. Nhiều thứ lắm.

Thường thì tôi digest 3 ug DNA dùng 20 U RE trong tối thiểu 3h, add cùng lúc hoặc 1 RE vào trước rồi 2h sau add RE.

Cái của em không phải cắt từ PCR mà cắt từ plasmid ra để dòng hóa vô plasmid khác để biểu hiện protein. Khi cắt bằng 2 RE em có sản phẩm như mong muốn đảm bảo là cắt hoàn toàn khi so sánh trên điện di agarose. Em lấy cái đó tinh chế qua gel để làm nguyên liệu cho phản ứng ligase. Thế nhưng kết quả ligase vẫn không ra? Trường hợp này tính sao anh? Trong khi đó em phải làm đi làm lại tỉ lệ nối khác nhau mãi mới có lần nó nối được. Theo em nghĩ tỉ lệ cũng rất quan trọng trong trường hợp này
 

Nguyễn Xuân Hưng

Administrator
Cái của em không phải cắt từ PCR mà cắt từ plasmid ra để dòng hóa vô plasmid khác để biểu hiện protein. Khi cắt bằng 2 RE em có sản phẩm như mong muốn đảm bảo là cắt hoàn toàn khi so sánh trên điện di agarose. Em lấy cái đó tinh chế qua gel để làm nguyên liệu cho phản ứng ligase. Thế nhưng kết quả ligase vẫn không ra? Trường hợp này tính sao anh? Trong khi đó em phải làm đi làm lại tỉ lệ nối khác nhau mãi mới có lần nó nối được. Theo em nghĩ tỉ lệ cũng rất quan trọng trong trường hợp này

Ah ừ, digest từ vector ra thì khác. Có sản phẩm rồi mà ligation không được thì lại do một số nguyên nhân khác. Bạn làm lúc được lúc không thì lại cần để ý đến khâu biến nạp, dùng tế bào khả biến tốt hay không, bước heat shock bao lâu, dùng bao nhiêu DNA để biến nạp, lúc plating có khi hơ que chang nóng quá vi khuẩn nó ngủ hết :D.... Mà cho mình hỏi các bạn tính tỷ lệ 1:3 theo kiểu cho 1ug vector vào 3ug inserted gene mà không quan tâm đến kích thước của chúng hay thế nào?

Cho tới nay mình made about 80 different constructs nhưng chỉ dùng mỗi 1 loại tỷ lệ và lần nào cũng thành công. Nhiều khi tức vì đĩa mọc nhiều colonies quá phải check nhiều. Thích nhất là cả 2 cái đĩa mọc mỗi 1-5 colonies hehe, khi đó nhặt con nào trúng con đó:oops:.
 

Dương Văn Cường

Administrator
Cho tới nay mình made about 80 different constructs nhưng chỉ dùng mỗi 1 loại tỷ lệ và lần nào cũng thành công
Sướng nhờ, toàn dùng KIT xịn nó khác.

Theo kinh nghiệm đau thương của mình việc tách dòng gene là một khâu như ma làm. Nhiều lúc làm đúng hết rồi mà đĩa vẫn trắng tinh. Một số vấn đề cần lưu ý như sau:

1. Tỉ lệ tính theo số copy chứ không tính theo thể tích :hihi: hoặc ng. Tỉ lệ 1 vector : 3 insert có nghĩa là cứ 1 phân tử DNA vector thì cần 3 phân tử insert. Có một số đồng chí lười đo nồng độ DNA cứ lấy 1 microlitre vector và 3 microlitre insert xong ghi labnote là tỉ lệ 3:1 :eek: , hay một số đồng chí khác sai lầm về mặt nguyên tắc là tính tỉ lệ theo số ng DNA. Theo kinh nghiệm của mình thì tỉ lệ cũng là một yếu tố ảnh hưởng đến kết quả clone, đặc biệt trong trường hợp khâu biến nạp của lab có hiệu suất không cao.

2. Nếu DNA vector hay DNA đoạn xen được tách chiết từ một loài sinh vật nào đó mà không phải là sản phẩm PCR, cần check methylation profile của sinh vật đó. Tớ đã từng clone mãi không được vì digest DNA vector (tách chiết từ vật chủ A) bằng một loại enzyme mà vị trí nhận biết này bị vật chủ A modify bằng methylation.

3. Khâu biến nạp cũng là một vấn đề thường gặp. Nếu hiệu suất biến nạp bằng heat shock không cao mình khuyến nghị các bạn chuyển sang phương pháp electroporation. Phương pháp này cho hiệu suất biến nạp thành công cao hơn nhiều. Luôn luôn phải setup positive control đề phòng trường hợp tế bào khả biến có vấn đề.

4. Cuối cùng, làm đúng hết rồi mà vẫn tạch thì kiếm 1 thằng ở lab hàng xóm đang clone ngon lành cành đào, nịnh nó để sử dụng toàn bộ dụng cụ, hóa chất, tế bào... của nó.

Thân ái quyết thắng :dance::dance::dance::dance::dance:
 
Ah ừ, digest từ vector ra thì khác. Có sản phẩm rồi mà ligation không được thì lại do một số nguyên nhân khác. Bạn làm lúc được lúc không thì lại cần để ý đến khâu biến nạp, dùng tế bào khả biến tốt hay không, bước heat shock bao lâu, dùng bao nhiêu DNA để biến nạp, lúc plating có khi hơ que chang nóng quá vi khuẩn nó ngủ hết :D.... Mà cho mình hỏi các bạn tính tỷ lệ 1:3 theo kiểu cho 1ug vector vào 3ug inserted gene mà không quan tâm đến kích thước của chúng hay thế nào?

Cho tới nay mình made about 80 different constructs nhưng chỉ dùng mỗi 1 loại tỷ lệ và lần nào cũng thành công. Nhiều khi tức vì đĩa mọc nhiều colonies quá phải check nhiều. Thích nhất là cả 2 cái đĩa mọc mỗi 1-5 colonies hehe, khi đó nhặt con nào trúng con đó:oops:.

Đảm bảo là competent cell rất ok, mọi thao tác làm thuần thục và không có hiện tượng đốt que còn nóng. Heat sock vẫn theo cổ điển thôi, 4oC sau đó là 42oC và 4oC. Đối với kích thước vector (2-6kb) thì em sử dụng khoảng 50ng vector DNA trong mỗi phản ề ứng. Về tỉ lệ thì đúng như anh nói, thường áp dụng là 1:1, 1:3 và 1:10. Tuy nhiên vẫn phải tính đến kích thước nữa. Ví dụ

Trong trường hợp dùng vector 3kb và đoạn insert cũng là 3kb thì tỉ lệ như sau:
● 1:1 = 50 ng vector + 50 ng insert
● 1:3 = 50 ng vector + 150 ng insert
● 1:10 = 50 ng vector + 500ng insert

Nếu 3 kb vector và 1 kb insert:
1:1 = 50 ng vector + 16.7 ng insert
● 1:3 = 50 ng vector + 50 ng insert
● 1:10 = 50 ng vector + 166.7 ng insert

Ví dụ đơn giản thế, và em cũng sài theo cách này. Hồi em làm tốt nghiệp cử nhân còn có cả công thức tính cho nó nữa cơ theo tỉ lệ nồng độ và kích thước nhưng hiện thì em hẻm nhở chính xác nó.
 
4. Cuối cùng, làm đúng hết rồi mà vẫn tạch thì kiếm 1 thằng ở lab hàng xóm đang clone ngon lành cành đào, nịnh nó để sử dụng toàn bộ dụng cụ, hóa chất, tế bào... của nó.

Em tâm đắc nhứt câu nói này của bác. He he, thế mới nói có người là bàn tay" vàng", làm đâu xong đó trong khi thằng làm theo y chang thì chẳng ra gì hết. It's science.
 

Nguyễn Xuân Hưng

Administrator
Đảm bảo là competent cell rất ok, mọi thao tác làm thuần thục và không có hiện tượng đốt que còn nóng. Heat sock vẫn theo cổ điển thôi, 4oC sau đó là 42oC và 4oC. Đối với kích thước vector (2-6kb) thì em sử dụng khoảng 50ng vector DNA trong mỗi phản ề ứng. Về tỉ lệ thì đúng như anh nói, thường áp dụng là 1:1, 1:3 và 1:10. Tuy nhiên vẫn phải tính đến kích thước nữa. Ví dụ

Trong trường hợp dùng vector 3kb và đoạn insert cũng là 3kb thì tỉ lệ như sau:
● 1:1 = 50 ng vector + 50 ng insert
● 1:3 = 50 ng vector + 150 ng insert
● 1:10 = 50 ng vector + 500ng insert

Nếu 3 kb vector và 1 kb insert:
1:1 = 50 ng vector + 16.7 ng insert
● 1:3 = 50 ng vector + 50 ng insert
● 1:10 = 50 ng vector + 166.7 ng insert

Ví dụ đơn giản thế, và em cũng sài theo cách này. Hồi em làm tốt nghiệp cử nhân còn có cả công thức tính cho nó nữa cơ theo tỉ lệ nồng độ và kích thước nhưng hiện thì em hẻm nhở chính xác nó.

Về cơ bản thế là đúng rồi. Còn nếu vẫn không được thì chắc do hàng ngày toàn làm chuyện ác, không chịu viết bài trên SHVN nên trời không thương:lol::lol::lol::lol:
 
1. Tính tỷ lệ vector:insert theo cách nào?

2. Thường thì ligation không thành công là do bước digest bằng 2 RE. Còn kích thước thì chẳng ảnh hưởng mấy. Quan trọng nhất là sản phẩm PCR, nêu ra đây xem bạn design primer với restriction site như thế nào. Bước digest bằng 2 RE ra sao? Còn ligation là cái dễ nhất trên đời, chẳng phải làm nhiều tỉ lệ làm gì cứ 1:3 là được rồi.

Goodluck

Quan trọng khi digest sản phẩm PCR là hai đầu restriction site dài ngắn thế nào. Chẳng hạn sản phẩm PCR thu được là

GAATTCNNNNNNNNNNNNNNNNNGAATTC sẽ khó digest bằng EcoRI hơn

NNNNNGAATTCNNNNNNNNNNNNNNNNNGAATTCNNNNNN

Enzyme mạnh thì rõ nhưng còn tùy thuộc dùng bao nhiêu unit, dành bao nhiêu thời gian để digest, và digest bao nhiêu DNA (ng) còn phụ thuộc digest bằng 2 RE thì chiến lược thế nào, đồng thời add cả hai một lúc, hay add lần lượt, hay digest bằng 1 RE rồi tinh sạch rồi add RE thứ 2. Nhiều thứ lắm.

Thường thì tôi digest 3 ug DNA dùng 20 U RE trong tối thiểu 3h, add cùng lúc hoặc 1 RE vào trước rồi 2h sau add RE.

- Insert của mình đựoc pcr từ BACs và với 3 cặp primer sk51 và sk54 cho đoạn 1500bp, sk52 va sk54 cho 1000bp, sk53 va sk54 cho đoạn 500bp
primer này là của bà Dr. Staphie Konrad trong Lab mình. đáng nhẽ làm với Pfu nhưng làm một lần với nó bị lỗi thế là làm đại với Taq
sk51 5 GCATTGCTAGCCTAGGAGCACACTG 3
SK52 5 GCATTGCTAGCGGTGTCAAAATGATGG 3
SK53 5 GCATTGCTAGCATATTAGTAGGTTG 3
SK54 3 CGTACACCGTCGATGATGATGG 5
- sản phẩm pcr sau khi tách ra digest cùng lúc bằng HindIII va NheI, vektor cũng được digest cùng lúc 2 RE này đều với 37đo, 2h ( hôm nay vừa mới digest lại vector HindII trước- kiểm tra bằng Gel, dùng Kit lấy lại va sau đó với NheI ( kết quả thì mai mới biết )
- còn Ligation tính tỷ lệ tất nhiên là không thể theo thể tích hay chỉ theo khối lượng ng được rồi mà phải tính theo độ dài vector
m insert [ng]= m vector [ng] x độ dài insert chia cho độ dài vector , và nhân với 3 hay 5 hay 10 tùy theo tỷ lệ mình làm.
ligation 15 phut lạnh đá, 2 phut 42 đo , 3 phút đá.sau đó mới LB vào..
compotente cell thì cũng đã kiểm tra lại competenz đều trên 10mũ7, kết quả khá tốt..compotent cell mình làm bằng Calciumchlorid-Method, không biết có phải đo Transfomation không nữa..
theo mình phán đoán thi do khâu digest có lẽ không tốt, và đã thử digest vector lại
 
kết qủa mới sau khi thử digest vector với hindII trước -tinh sạch -và digest tiếp với NheI , nhưng làn này thì tệ hơn lần trước là chảng thu được khuẩn lạc nào, đĩa trắng tinh , chỉ có 3 cái nhi tí..,
có lẽ là insert digest không được tốt chăng ..?????chắc phải test lại tất cả quá ...
đoạn 500bp gửi sequencing thì ok rùi.
 

arinaga

New member
e xin lôi cái topic này lên, các ac giúp e với, e ko thể insert vào plasmid đc, toàn thất bại

e muốn insert 1 đoạn 1800bp, OD là 25, dùng kit TOPO, với vector pCR 2.1 nồng độ là 10ng/ul, độ dài 3900bp

kit ghi mix của ligate là 6ul gồm:
sp insert 0.5-4ul
vector 1
Salt 1
H2O vừa đủ 6ul

e cũng đã thử mấy lần theo tỷ lệ 1,2,3,4 ul nhưng kq là có khuẩn lạc trắng nhưng ko có sp khi điện di

e cũng thử tính theo CT để xác định nồng độ cần thiết của đoạn insert là 10*1800/3900=4.6ng/ul

vậy từ 4.6 ng/ul thì OD e đo đc là 25 thì thể tích cần thiết của đoạn insert là bn?

Anh chị nào tính giúp e với mà tại sao toàn failure thôi:cry:
 

VET

Member
Mình cũng gặp trường hợp không insert được vào TOPO2.1 với các insert dài hơn 1,5kb. Sau đó mình dùng TOPO-XL, quá trình chuẩn bị insert yêu cầu rất khắt khe: tránh UV, đảm bảo có A overhang… thì insert thành công. Nhưng vì loại này (vẫn là của Promega) so với TOPO2.1 thì đắt hơn nhiều lần nên sau đó mình đã quay lại dùng TOPO2.1 thì thấy cũng OK. Từ đó với một số lưu ý dưới đây, đến nay trên dưới 100 insert dài từ 1kb đến 2,5kb mình ligate với TOPO2.1 thấy rất hiệu quả (hình như chưa lần nào phải lặp lại):

- Khi chạy PCR, nếu dùng Taq cho thời gian 72oc của vòng cuối dài (khoảng 10 đến 30 phút). Nếu dùng enzyme khác (như pfu trong trường hợp của mình) thì sau khi thôi gen cho Taq, dNTP, buffer (không có primer) vào chạy PCR 10-20 vòng sau đó lại thôi gen lại rồi mới ligate với vector.

- Không dùng UV để thấy và cắt band (cái này rất quan trọng).

- Mình không đo để tính tỷ lệ insert/vector bao giờ, nhưng mình thường tối đa lượng insert có thể dùng.

- Nếu muốn tiết kiệm có thể dùng ½ lượng vector và competent cell như sau: insert 2ul + vector 0,5ul + salt 0,5ul = 3ul và 3ul này (ligate trong vòng 5 phút) cho vào ½ Top10 competent cell (=25ul). Như vậy một hộp kít Topo2.1 mình clone được khoảng 20-21 insert, tiết kiệm 50% tiền.
 

Nguyễn Xuân Hưng

Administrator
e xin lôi cái topic này lên, các ac giúp e với, e ko thể insert vào plasmid đc, toàn thất bại

e muốn insert 1 đoạn 1800bp, OD là 25, dùng kit TOPO, với vector pCR 2.1 nồng độ là 10ng/ul, độ dài 3900bp

kit ghi mix của ligate là 6ul gồm:
sp insert 0.5-4ul
vector 1
Salt 1
H2O vừa đủ 6ul

e cũng đã thử mấy lần theo tỷ lệ 1,2,3,4 ul nhưng kq là có khuẩn lạc trắng nhưng ko có sp khi điện di

e cũng thử tính theo CT để xác định nồng độ cần thiết của đoạn insert là 10*1800/3900=4.6ng/ul

vậy từ 4.6 ng/ul thì OD e đo đc là 25 thì thể tích cần thiết của đoạn insert là bn?

Anh chị nào tính giúp e với mà tại sao toàn failure thôi:cry:

1. Xem lại cách đo OD cũng như công thức tính nồng độ DNA từ OD.

2. Có khuẩn lạc trắng nhưng điện di không lên. Ý bạn là sau khi PCR colonies không có sản phẩm, hay pick khuẩn lạc đêm nuôi, tách plasmid xong điện di không thấy bands?

3. Bản chất insert của bạn là gì (sản phẩm PCR hay 1 đoạn DNA sau khi digest bằng restriction enzyme....)?
 

arinaga

New member
OD e đo bằng máy nanodrop, e cũng chưa rõ CT tính DNA từ OD, mong bác nói thêm

E nhặt colony vừa chạy PCR vừa cấy mù đồng thời để qua đêm, PCR xuất hiện band mong muốn thì nuôi tiếp trên LB lỏng rồi tách plasmid rồi check lại trên PCR

Bản chất insert là 1 đoạn DNA ko phải PCR product đâu ạ

Thực ra thì đoạn <1000bp thì insert đc khá dễ, còn môt số đoạn từ 1400-2400 thì đi vào ngõ cụt

E sẽ chú ý theo lời khuyên của bác VET mặc dù trước khi ligate, purify bằng gel đã kiểm tra thấy vẫn có band của đoạn insert, khi đó mới bắt đầu clone
hix, nhức đầu quá :dapchet:
 
TOPO cloning có cả AT cloning có cả blunt end cloning mà. Đâu phải cái nào cũng cần A tailing đâu bạn VET?
Mấy cái cloning này, nếu mà RE cloning thì làm khoảng vài ống, để qua đêm 16C rồi cất vào tủ lạnh backup. Biến nạp hôm nay không được mai lấy backup ra biến nạp tiếp. Còn TOPO kit thì có khi phải kiểm tra lại enzyme/buffer thôi.

Nếu bạn có nhiều khuẩn lạc trắng và vài khuẩn lạc xanh, cách screen nhanh nhất là One-step Miniprep như sau:
Nhặt vài chục khuẩn lạc trắng và khoảng 2-3 khuẩn lạc xanh đem đi làm replica plate và đồng thời nuôi vào 400 ul LB+kháng sinh trong 6 tiếng. Đem ly tâm thu tế bào. Decant môi trường
Cho 20 ul PCI(phenol-chloroform-isoamyl) và 40 ul 6x loading buffer vào và mix bằng vortex trong 20-30''. Ly tâm 10 phút và lấy khoảng 10 ul chạy. Nhớ đánh dấu xanh trắng nằm ở lane nào. Chọn lane nào băng nằm cao nhất so với các băng khác đem đi kiểm tra thêm. Nếu thấy băng nằm trên 1 đường thẳng hết thì xem lại toàn bộ quy trình ligation.
 

VET

Member
Việc mình đang làm có 1 công đoạn liên quan đến cloning nên mình mới học làm cloning mấy tháng nay. Nghe bà con thảo luận cũng mở mang thêm được nhiều. Mình cứ đinh ninh kit TOPO, với vector pCR 2.1 như bạn arinaga nói là dùng cho AT cloning thôi chứ nhỉ.
Chà chà, nhiều cái phải học quá
 

Facebook

Top