What's new

Primer Sequence

phuongtu

New member
Gửi các anh, chị!

Em tham khảo thấy trình tự T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'.

Ký tự "d" đằng trước dãy trình tự mang ý nghĩa gì, mong các anh, chị giải thích hộ em.

(y)
 

Facebook

Top